Open Access

A single nucleotide polymorphism in the Epstein-Barr virus genome is strongly associated with a high risk of nasopharyngeal carcinoma

  • Fu-Tuo Feng1, 2,
  • Qian Cui1, 2,
  • Wen-Sheng Liu1, 2,
  • Yun-Miao Guo1, 2,
  • Qi-Sheng Feng1, 2,
  • Li-Zhen Chen1, 2,
  • Miao Xu1, 2,
  • Bing Luo3,
  • Da-Jiang Li1, 2,
  • Li-Fu Hu4,
  • Jaap M. Middeldorp5,
  • Octavia Ramayanti5,
  • Qian Tao6,
  • Su-Mei Cao1, 7,
  • Wei-Hua Jia1, 2,
  • Jin-Xin Bei1, 2Email author and
  • Yi-Xin Zeng1, 2Email author
Contributed equally
Chinese Journal of Cancer201534:61

DOI: 10.1186/s40880-015-0073-z

Received: 25 July 2015

Accepted: 18 November 2015

Published: 16 December 2015

Abstract

Background

Epstein-Barr virus (EBV) commonly infects the general population and has been associated with nasopharyngeal carcinoma (NPC), which has a high incidence in certain regions. This study aimed to address how EBV variations contribute to the risk of NPC.

Methods

Using logistic regression analysis and based on the sequence variations at EBV-encoded RPMS1, a multi-stage association study was conducted to identify EBV variations associated with NPC risk. A protein degradation assay was performed to characterize the functional relevance of the RPMS1 variations.

Results

Based on EBV-encoded RPMS1 variations, a single nucleotide polymorphism (SNP) in the EBV genome (locus 155391: G>A, named G155391A) was associated with NPC in 157 cases and 319 healthy controls from an NPC endemic region in South China [P < 0.001, odds ratio (OR) = 4.47, 95% confidence interval (CI) 2.71–7.37]. The results were further validated in three independent cohorts from the NPC endemic region (P < 0.001, OR = 5.20, 95% CI 3.18–8.50 in 168 cases vs. 241 controls, and P < 0.001, OR = 5.27, 95% CI 4.06–6.85 in 726 cases vs. 880 controls) and a non-endemic region (P < 0.001, OR = 7.52, 95% CI 3.69–15.32 in 58 cases vs. 612 controls). The combined analysis in 1109 cases and 2052 controls revealed that the SNP G155391A was strongly associated with NPC (P combined  < 0.001, OR = 5.27, 95% CI 4.31–6.44). Moreover, the frequency of the SNP G155391A was associated with NPC incidence but was not associated with the incidences of other EBV-related malignancies. Furthermore, the protein degradation assay showed that this SNP decreased the degradation of the oncogenic RPMS1 protein.

Conclusions

Our study identified an EBV variation specifically and significantly associated with a high risk of NPC. These findings provide insights into the pathogenesis of NPC and strategies for prevention.

Keywords

Epstein-Barr virus Nasopharyngeal carcinoma RPMS1 Association

Background

Nasopharyngeal carcinoma (NPC) is a malignancy with a marked geographic distribution and ethnic tendencies, occurring with high frequencies in South China, Southeast Asia, North Africa, and Alaska [1]. The etiology of NPC is complex, involving multiple factors such as genetic susceptibility, Epstein-Barr virus (EBV) infection, and environmental factors [24]. The known association between EBV and NPC was mainly driven by findings that EBV-encoded molecules, some of which are potentially oncogenic, were consistently observed in nearly all NPC tissues and that EBV serological markers, including viral DNA load and antibodies against viral antigens, were associated with NPC diagnosis and prognosis [57].

EBV infection is ubiquitous, affecting more than 95% of the worldwide population; EBV was also the first virus identified in a human tumor, i.e., Burkitt’s lymphoma. EBV has also been closely associated with Hodgkin’s lymphoma and some gastric cancers [8]. The incidences of these malignancies show remarkably different geographic distributions [9], which is paradoxical in comparison to the widespread infection with EBV. Moreover, sequence diversity in EBV genes has been demonstrated among the general population and in different tumor types [10, 11]. These results suggest the hypothesis that there might be some disease-specific EBV subtypes preferentially hazardous to certain populations, making them more prone to certain specific diseases such as NPC.

A number of studies have reported attempts to identify NPC-specific EBV subtypes using restriction fragment length polymorphism analysis and DNA sequencing based on the sequence variations of EBV genes. These genes were consistently observed in NPC tissues, including EBV nuclear antigens (EBNAs), latent membrane proteins (LMP1 and LMP2), and EBV-encoded small nuclear RNAs (EBERs) [9, 10, 12]. EBV can be characterized as Type 1 (Type A) or Type 2 (Type B) based on the sequence diversity of EBNA2 and EBNA3s [13, 14]. Type 1 EBV strains are more common worldwide, whereas Type 2 is equally prevalent in parts of Africa [1517]. Based on an amino acid polymorphism at position 487 of EBNA-1, EBV has been classified into five strains: P-ala (B95-8 prototype), P-thr, V-val, V-leu, and V-pro [1820]. V-val was detected almost exclusively in Chinese populations, whereas P-ala and P-thr were detected with a high prevalence in healthy individuals from both Chinese and non-Chinese populations [21, 22]. Based on the nucleotide sequence variations at the LMP1 C-terminus, EBV can be separated into seven strains: China 1, China 2, Med, China 3, Alaskan, NC, and B95-8 [23]. Among the Asian isolates, China 1 and B95-8 were identified in healthy subjects, and China 1 and China 2 were found in NPC patients [23]. It has been reported that the Cantonese population is susceptible to the predominant China 1 strain in the NPC endemic region in China [24]. These investigations suggested that there were relatively stable genomic variations in EBV and that different subtypes might exist in different geographic regions.

To further identify EBV variations linked closely to NPC risk, we conducted a pilot association analysis on several important EBV-encoded genes, including LMP1, EBNA1, and the BamHI-A rightward transcripts (BARTs) family, starting from NPC cases and healthy controls in the Cantonese population in South China. The most striking finding is that a single nucleotide polymorphism (SNP) in the EBV-encoded RPMS1 gene (locus 155391: G>A, named G155391A) is significantly associated with NPC incidence.

Previous studies have demonstrated that the BARTs family members are abnormally expressed in most NPC tissues and might contribute to NPC development [25, 26]. RPMS1 encodes a major part of the mRNA of the BARTs family and is regularly transcribed in NPC tissues [26, 27]. In particular, abundant RPMS1 mRNA was detected in NPC tissues and cell lines [28]. Considering the potential roles of RPMS1 in NPC oncogenesis [25, 27, 29], we speculated that the sequence variation of RPMS1 might contribute to the incidence variations of NPC among different geographic regions and ethnic groups. Therefore, we conducted a large-scale case–control study using a multistage design to identify the association between RPMS1 variations and NPC risk.

Methods

Subjects and samples

For the pilot study, 60 paired NPC cases and healthy controls were recruited from Sun Yat-sen University Cancer Center (SYSUCC) between October 2005 and October 2007. Throat washing (TW) samples were subjected to polymerase chain reaction (PCR) and direct DNA sequencing to screen for genomic variations exhibiting significant differences between the cases and controls.

The discovery stage involved 346 sporadic Cantonese NPC patients and 448 healthy subjects (Data_GD1), recruited from SYSUCC and the First Affiliated Hospital of Sun Yat-sen University (1st AH-SYSU), Guangdong Province, an NPC endemic region in South China, between October 2005 and October 2007.

In the validation stage, three independent sample cohorts were collected from the NPC endemic and non-endemic regions in China between October 2008 and June 2013. The first group consisted of 222 TW samples from sporadic NPC patients and 315 TW samples from healthy subjects from the SYSUCC and the 1st AH-SYSU (Data_GD2). The second group consisted of 1065 TW samples from sporadic NPC patients and 1161 TW samples from healthy subjects from the local community hospitals in Guangdong Province (Data_GD3). The third group consisted of 36 tumor biopsy (TB) samples and 66 TW samples from NPC patients from the Affiliated Hospital of Qingdao University (AH-QDU) and Shandong Province Cancer Center, in addition to 1543 TW samples from healthy subjects from the physical examination centers at local community hospitals in Shandong Province, a NPC non-endemic region in North China (Data_SD) (Table 1).
Table 1

Characteristics of samples from nasopharyngeal carcinoma (NPC) cases and healthy controls from the four case–control datasets

Dataset

Region

Period

NPC cases

Healthy controls

Note

Detected/total (no.)

Source

Detected/total (no.)

Source

Data_GD1

Guangdong

Oct 2005–Oct 2007

157/346

Sun Yat-sen University Cancer Center (SYSUCC)

319/448

The First Affiliated Hospital of Sun Yat-sen University (1st AH-SYSU)

NPC endemic

Data_GD2

Guangdong

Oct 2008–Jun 2013

168/222

SYSUCC

241/315

1st AH-SYSU

NPC endemic

Data_GD3

Guangdong

Oct 2008–Jun 2013

726/1065

Local hospitals in Guangdong province

880/1161

Local hospitals in Guangdong province

NPC endemic

Data_SD

Shandong

Oct 2008–Jun 2013

58/102

The Affiliated Hospital of Qingdao University, the Shandong Province Cancer Center

612/1543

Local hospitals in Shandong province

NPC non-endemic

In the same period, additional TB samples from NPC patients were collected from NPC endemic regions in Asia, including 122 samples from SYSUCC, 30 samples from the National Cancer Center of Singapore in Singapore, and 30 samples from the Chinese University of Hong Kong in Hong Kong. TB samples from patients with EBV-related malignancies were also collected, including 10 samples of gastric carcinoma from AH-QDU and 23 samples of lymphoma (Burkitt’s, NK/T cell, or Hodgkin’s) from SYSUCC. An additional 39 TW samples from patients with non-EBV-associated cancers were collected at SYSUCC. TW samples were also collected from healthy subjects in NPC non-endemic regions, including 83 samples from the Medical Examination Center of Henan Provincial Military Department in Henan Province, 100 samples from the Beijing Centers for Diseases Control and Prevention in Beijing, 116 samples from the Third People’s Hospital of Datong in Shanxi Province, and 11 Caucasian samples from the Karolinska Institute in Sweden and the VU University Medical Center in Netherlands.

The selection criteria for patients were self-reported Chinese and newly diagnosed patients without any radiotherapy, chemotherapy, or surgery. TW samples were collected before any treatment. Basic information was also collected from the participants regarding age, gender, residential region, ethnicity, and familial history of NPC or other cancers. Healthy controls with no self-reported history of cancer were randomly recruited from physical examination centers in hospitals and were frequency-matched to the cases by age (±5 years), gender, residential region, and ethnicity. This study was approved by the Human Ethics Committee at SYSUCC. Written informed consent was obtained from all the participants.

Isolation of DNA

Genomic DNA from TW samples was prepared using a conventional method. Briefly, the subjects rinsed their mouths with 15 mL of 0.9% saline for 10 s. Buccal epithelial cells were pelleted by centrifugation at 5000×g for 10 min. The cells were re-suspended and digested in a lysis buffer [10 mmol/L Tris·HCl with pH 8.0, 100 mmol/L NaCl, 25 mmol/L ethylene diamine tetraacetic acid (EDTA), 0.5% Sarkosyl, and 0.1 mg/mL proteinase K] for 1–2 h at 55 °C. After treatment with RNase A, DNA was extracted from the cell lysate by adding phenol/chloroform and then precipitated with ethanol, followed by dissolving in 50 μL of water. Genomic DNA from TB samples and cells was extracted using a commercial DNA extraction kit (DNeasy Blood & Tissue Kit, Qiagen, Valencia, CA, USA).

Sequence analysis and detection of SNP in RPMS1

In the pilot study, sequences of LMP1, EBNA1, and the BARTs family were detected by standard PCR and the direct Sanger sequencing method [22]. For RPMS1, only the second coding exon was considered (sequence length approximately 282 bp, covering 89.74% of the RPMS1 coding region), as there was no variation in the first exon according to pairwise comparisons among GD1, AG876, and two wild-type EBV genomes (GenBank Accession No. AY961628, DQ279927, AJ507799, and NC_007605). Considering the low number of DNA copies of EBV in the TW samples, three rounds of nested PCR were subsequently conducted to amplify the RPMS1 fragment as a way to increase the detection rate. Three primer pairs are listed in Table 2. In the first round, 2 μL of each genomic DNA served as the template, and PCR was performed in a 25-μL reaction system containing 0.25 μL of 20 μmol/L primer pair RPMS1-1/2, 2.0 mmol/L magnesium chloride, 0.2 mmol/L of each dNTP, and 0.625 unit of Go Taq DNA polymerase (Promega, Madison, WI, USA). In the second round, 2 μL of mixture from the first round PCR was used as the template with the primer pair RPMS1-3/4 in a 25-μL reaction system. In the third round, the template was 5 μL of mixture from the second round PCR, using the primer pair RPMS1-5/6, in a 50-μL reaction system. Raji DNA and water were used as positive and negative controls, respectively. The amplification procedures for each round followed the manufacturer’s protocol. After PCR amplification, the nucleotide sequences of the PCR products were determined by Sanger sequencing (Fig. 1).
Table 2

Primers used in the nested polymerase chain reaction (PCR) and their sequences

Primer

EBV locusa

Sequences (5′ → 3′)

Note

EBNA1-1

96,750–67

GGGAAGTCGTGAAAGAGC

Outer primer

EBNA1-2

97,479–96

GGTGGAAACCAGGGAGGC

EBNA1-3

97,052–72

GGTTTGGAAAGCATCGTGGTC

Inner primer

EBNA1-4

97,390–410

AACAAGGTCCTTAATCGCATC

LMP1-CT-1

167,623–42

GCTAAGGCATTCCCAGTAAA

Outer primer

LMP1-CT-2

168,268–86

GATGAACACCACCACGATG

LMP1-CT-3

167,755–72

CGGAACCAGAAGAACCCA

Inner primer

LMP1-CT-4

168,244–61

TCCCGCACCCTCAACAAG

RPMS1-1

155,087–107

GCTGGGTTGATGCTGTAGATG

1st round nested

RPMS1-2

155,799–819

AGGGTCTGGACGTGGAGTTTG

RPMS1-3

155,103–121

AGATGTGCCTGGCTCTGTC

2nd round nested

RPMS1-4

155,543–63

CAATGACTTTGTCACCTTTGG

RPMS1-5

155,199–220

AGAAGGCGTAGAGCATGTCCAG

3rd round nested

RPMS1-6

155,460–81

GAGTACGACTGTGAGGTGGGCG

EBV Epstein-Barr virus, EBNA1 EBV nuclear antigen 1, LMP1 latent membrane protein 1

aCoordinates relative to complete wild-type EBV genome (GenBank Accession No. NC_007605)

https://static-content.springer.com/image/art%3A10.1186%2Fs40880-015-0073-z/MediaObjects/40880_2015_73_Fig1_HTML.gif
Fig. 1

Validation of the RPMS1 single nucleotide polymorphism (SNP) G155391A by Sanger sequencing. a Representative RPMS1 155391G variant (wild type). b Representative RPMS1 155391A variant (mutant type). c Representative mixture type, individuals infected with both RPMS1 155391G and 155391A variants

Cell culture

NP69 is an immortalized human nasopharyngeal epithelial cell line originally presented by George Tsao at the University of Hong Kong and maintained at SYSUCC. NP69 cells were grown in defined Keratinocyte serum-free medium supplemented with epidermal growth factor (EGF) (Invitrogen, Grand Island, NY, USA). The purity of NP69 cells was verified using short tandem repeat (STR) markers with the Goldeneye™20A STR kit (Peoplespot Co., Beijing, China) and an ABI 3100 analyzer (Thermo Fisher Scientific, Grand Island, NY, USA). Raji and C666-1 cells were maintained at our laboratory and cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA). 293T cells were maintained at our laboratory and grown in Dulbecco’s modified eagle medium supplemented with 10% fetal bovine serum (Gibco). All cells were cultured in a humidified chamber with 5% CO2 at 37 °C.

Plasmids and generation of stable RPMS1 expression transfectants

Full-length cDNA of RPMS1 was obtained by PCR from the cDNA library derived from the EBV-positive NPC cell line C666-1 and then cloned into the pBABE-Puro retroviral vector (Cell Biolabs, San Diego, CA, USA). Mutations were introduced using the Quick-Change Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, CA, USA), and all mutations were verified by Sanger sequencing. The pBABE-Puro-RPMS1 (-Mut/-WT) expression vectors (constructed at our laboratory) and their corresponding control vectors (Cell Biolabs) were packaged into the retrovirus generated by 293 T cells, followed by the infection of NP69 cells. The respective stable transfectants in NP69 cells were selected against 1 μg/mL of puromycin.

Western blotting

Western blotting was performed as described previously [30]. Briefly, cells were lysed in mammalian cell lysis buffer, and proteins within the clarified lysates were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes for immunoblotting against the corresponding antibody. The results were revealed using enhanced chemiluminescent (ECL) detection reagents (Beyotime Co., Shanghai, China). The rabbit polyclonal anti-RPMS1 antibody was from Proteintech Group Inc. (Wuhan, Hubei, China), and the human anti-β-actin antibody was from Sigma-Aldrich Co. (St. Louis, MO, USA). A horseradish peroxidase (HRP)-conjugated anti-rabbit IgG antibody was used as the secondary antibody (Promega, Madison, WI, USA).

Statistical analysis

To test the association between EBV variations and NPC risk, odds ratios (ORs) and 95% confidence intervals (CIs) were estimated by unconditional logistic regression. Subjects with the EBV prototype (155391G) were treated as the reference. ORs were adjusted for gender and age, where both were taken as categorical covariates (female or male; ≤35, 35–65, and >65 years). Fisher’s exact test was used to assess the frequency distribution of variables in two or more groups. The NPC risk associated with the affected EBV variations was characterized using the Cochran-Armitage trend test in the logistic regression analysis with adjustment for gender and age, where the variables of the EBV variations 155391G, 155391G/A, and 155391A were coded by 0, 1, and 2 in the statistical model, respectively. All statistical analyses were performed using the R3.0.1 software (http://www.r-project.org/). A P value of less than 0.05 was considered significant.

Results

Association between a SNP in the EBV genome and high risk of NPC

To identify genomic variations related to the NPC disease phenotype, in the pilot study, we sequenced the genomic regions of EBV-encoded genes, including LMP1, EBNA1, and the BARTs family, in 60 paired TW samples from NPC patients and healthy controls from a Cantonese population. Because, in NPC patients, multiple subtypes of EBV infection could be detected frequently in peripheral blood samples, and the EBV subtype detected in the normal nasopharyngeal tissues was more similar to the subtype in the TB samples [16, 22], we chose to sequence DNA extracted from the TW samples. We found one SNP in RPMS1 (Loc155391 G>A) with a significant difference between the cases and controls, and all the subsequent experiments on larger sample sizes were then focused on this genomic variation. In contrast, no significant associations with NPC risk were observed at the EBNA1 and LMP1 loci (Table 3).
Table 3

Association between variations of EBNA1 and LMP1 in throat washing (TW) samples and the risk of NPC in Guangdong population (pilot study)

Gene

Subtype

NPC [no. (%)]

Healthy subjects [no. (%)]

P

RPMS1

<0.001

 

155391G

8 (16.0)

29 (53.7)

 
 

155391G/A

0

4 (7.4)

 
 

155391A

42 (84.0)

21 (38.9)

 

EBNA1

0.677

 

V-val

45 (90.0)

44 (84.6)

 
 

P-ala

1 (2.0)

2 (3.8)

 
 

P-thr

2 (4.0)

1 (1.9)

 
 

Mix

2 (4.0)

5 (9.6)

 

LMP1

0.080

 

China 1

27 (64.3)

39 (68.4)

 
 

China 2

4 (9.5)

2 (3.5)

 
 

B95.8

2 (4.8)

10 (17.5)

 
 

Mix

9 (21.4)

6 (10.5)

 

Mix mixture of two or more EBV subtypes. Other abbreviations as in Tables 1 and 2

In the discovery stage, TW samples from 157 NPC patients and 319 controls recruited from Guangdong Province were genotyped based on the 2nd exon sequence of RPMS1 (Data_GD1; Table 1). The SNP was recognized as Loc155391 (G>A) based on its coordinates mapping to the wild-type EBV genome (GenBank Accession No. NC_007605). Logistic regression analysis with adjustment for age and gender revealed a strong association of the SNP at Loc155391 (named as G155391A) with a high risk of NPC (P < 0.001, OR = 4.47, 95% CI 2.71–7.37; Table 4).
Table 4

Single nucleotide polymorphism (SNP) G155391A of RPMS1 and NPC risk

EBV variant

NPC

Healthy subjects

OR

95% CI

P value

Data_GD1

 155391G

28

132

1

  

 G155391A

10

40

1.53

0.66–3.54

0.321

 155391A

119

147

4.47

2.71–7.37

<0.001

 P trend

    

<0.001

Data_GD2

 155391G

28

125

1

  

 G155391A

2

5

1.98

0.35–11.33

0.443

 155391A

138

111

5.20

3.18–8.50

<0.001

 P trend

    

<0.001

Data_GD3

 155391G

99

357

1

  

 G155391A

12

84

0.61

0.32–1.17

0.136

 155391A

615

439

5.27

4.06–6.85

<0.001

 P trend

    

<0.001

Data_SD

 155391G

40

560

1

  

 G155391A

0

18

0

0-Inf

0.987

 155391A

18

34

7.52

3.69–15.32

<0.001

 P trend

    

<0.001

Overalla

 155391G

195

1174

1

  

 G155391A

24

147

0.92

0.56–1.51

0.746

 155391A

890

731

5.27

4.31–6.44

<0.001

 P trend

    

<0.001

 I 2

  

0

  

 P

    

0.710

OR odds ratio, 95% CI 95% confidence interval, Inf Infinity. Other abbreviations as in Tables 1 and 2

aDatasets integrated by meta-analysis

P trend Cochran-Armitage trend test in logistic regression analysis with adjustment for age and gender

P heterogeneity test among the four datasets

Replication analyses

To replicate the association, Loc155391 was genotyped in two independent sample groups recruited from the same NPC endemic region, consisting of 168 NPC patients and 241 healthy controls from Data_GD2 and 726 NPC patients and 880 healthy controls from Data_GD3 (Table 1). Logistic regression analysis showed that SNP G155391A was significantly associated with a high NPC risk in both sample groups (Data_GD2: P < 0.001, OR = 5.20, 95% CI 3.18–8.50; Data_GD3: P < 0.001, OR = 5.27, 95% CI 4.06–6.85; Table 4), indicating that the strong association was replicated in the two independent sample groups. As further confirmation, logistic regression analysis for SNP G155391A was conducted in another sample group from Shandong Province in North China, which is a NPC non-endemic region, involving 58 NPC patients and 612 healthy controls (Data_SD). The result revealed a consistently strong association between SNP G155391A and a high NPC risk (P < 0.001, OR = 7.52, 95% CI 3.69–15.32; Table 4), indicating that the association was further replicated. Meta-analysis of all the four samples with a total of 1109 NPC patients and 2052 healthy controls showed that SNP G155391A was associated with a high risk of NPC among all tested regions (P < 0.001, OR = 5.27, 95% CI 4.31–6.44), and there was no evidence of heterogeneity among the included cohorts (P = 0.71; Table 4). In addition, no other variations of RPMS1 were observed in any of the four sample groups.

Association of RPMS1 SNP G155391A and incidences of NPC and other malignancies

The frequencies of SNP G155391A were counted and compared among samples from Guangdong in South China, which is an NPC endemic region, as well as in North China and Europe, where NPC incidence is relatively low. High frequencies of SNP G155391A were detected among the controls from Guangdong (48.4%), whereas the frequencies were significantly lower in North China (1.2%–8.0%) and Europe (0) (P < 0.001; Table 5). The increasing trend in the frequency of SNP G155391A in samples from regions with low to high NPC incidence was consistently observed in NPC patients, using either TW or TB samples (both P < 0.001; Table 5). These results indicated that the frequency of SNP G155391A was associated with the NPC incidence and was significantly increased in the tumor tissues. Moreover, as Burkitt’s lymphoma, Hodgkin’s lymphoma, NK/T-cell lymphoma, and some gastric cancers are well known as EBV-related malignancies, we compared the distributions of the RPMS1 SNP G155391A between other cancer samples and healthy controls. Interestingly, no evidence of association was observed between the RPMS1 SNP G155391A and the risks of tested cancers except for NPC (P > 0.05; Table 6), suggesting that the association with the high-risk EBV variant might be specific to NPC.
Table 5

The frequencies of RPMS1 SNP G155391A in NPC cases and healthy controls from various world regions

Sample

Source

Region

No. (sum)

G155391A

Frequency of G155391A (%)

NPC incidence

P*

G

G/A

A

NPC

TB

Shandong

36

23

0

13

36.1

Low

 
  

Guangdong

122

22

0

100

82.0

High

 
  

Hong Kong

30

2

0

28

93.3

High

 
  

Singapore

30

9

0

21

70.0

High

<0.001

 

TW

Shandong

22

17

0

5

22.7

Low

 
  

Guangdong

1051

155

24

872

83.0

High

<0.001

Healthy subjects

TW

Europe

11

11

0

0

0.0

Low

 
  

Henan

83

81

1

1

1.2

Low

 
  

Beijing

100

91

1

8

8.0

Low

 
  

Shanxi

116

109

1

6

5.2

Low

 
  

Shandong

612

560

18

34

5.6

Low

 
  

Guangdong

1440

614

129

697

48.4

High

<0.001

TB tumor biopsy. Other abbreviations as in Tables 1 and 2

* Data combined in regions with low/high NPC incidence and probability calculated by Fisher’s exact test

Table 6

Association of RPMS1 SNP G155391A with the risk of NPC and other malignancies

Region

Sample

Source

155391G & 155391G/A

155391A

OR

P

Guangdong

Healthy subjectsa

TW

743

697

1

 
 

EBV-free tumor#

TW

24

15

0.67

0.257

 

NHL

TB

8

5

0.67

0.582

 

HL

TB

7

3

0.46

0.345

 

Lymphoma (NHL + HL)

TB

15

8

0.57

0.213

 

NPC

TB

22

100

8.35˄

<0.001

Shandong

Healthy subjectsa

TW

578

34

1

 
 

EBVaGC

TB

10

0

0

1.000

 

NPC

TB

23

13

Inf˅

0.042

NHL non-Hodgkin’s lymphoma, HL Hodgkin’s lymphoma, EBVaGC EBV-associated gastric carcinoma. Other abbreviations as in Tables 1 and 2

aHealthy subjects from the discovery and replication stages were combined

#EBV-free tumors included lung cancer, liver cancer, colorectal cancer, and pancreatic cancer, among others, which were not associated with EBV

NHL included Burkitt’s and NK/T-cell lymphomas

The frequency of RPMS1 SNP G155391A in healthy subjects from the same region was considered as a reference, with Fisher’s exact test performed

˄Lymphoma was considered as a reference

˅EBVaGC was considered as a reference

Functional characterization of RPMS1 SNP G155391A

Endogenous RPMS1 protein was not detected, even though RPMS1 was implicated in NPC development. Although the BARTs contain many EBV-encoded microRNA precursors [31], we failed to detect any alteration in the microRNAs predicted in the regions near RPMS1 between the wild-type (155391G) and mutant (155391A) RPMS1 (data not shown). Thus, we suspected that the variation of G155391A from guanine (G) to adenine (A), leading to the amino acid change from Asp (D) to Asn (N), might be related to RPMS1 transcription or expression. Variations of the stable nasopharyngeal epithelial cell line NP69 integrating pBABE-Puro retroviral vector with mutant RPMS1 (155391A), wild-type RPMS1 (155391G), and empty vector, respectively, were successfully constructed as revealed by Western blotting (Fig. 2a). After cycloheximide (CHX) treatment, RPMS1 protein degradation was clearly proceeding after 0.5 h in the NP69 cells with wild-type RPMS1 (155391G), whereas the degradation was hampered in the NP69 cells with mutant RPMS1 (155391A) (Fig. 2b). Moreover, the damped exponential model indicated that the half-life for the mutant RPMS1 protein was significantly longer than that for the wild-type protein (3.2 vs. 0.6 h, P < 0.001; Fig. 2c), suggesting that the SNP G155391A is functionally regulating the protein stability of RPMS1. In addition, when treated with the proteasome inhibitor MG132, a significant increase in RPMS1 protein expression was observed in the stable NP69 cell lines with overexpression of either wild-type (155391G) or mutant RPMS1 (155391A) (Fig. 2d), suggesting that the RPMS1 protein might be degraded through the ubiquitin–proteasome pathway.
https://static-content.springer.com/image/art%3A10.1186%2Fs40880-015-0073-z/MediaObjects/40880_2015_73_Fig2_HTML.gif
Fig. 2

Effect of the RPMS1 SNP G155391A on the degradation of RPMS1 protein. a Western blotting analysis showing the expression levels of RPMS1 in NP69 cell lines established with the stable integration of the pBABE-Puro retroviral vector of mutant RPMS1 (-Mut), wild-type RPMS1 (-WT), and control vector (-Vec), respectively. b Western blotting results showing the degradation of RPMS1 protein. NP69 cells with stable overexpression of mutant RPMS1 (-Mut) or wild-type RPMS1 (-WT) were incubated with 20 μg/mL cycloheximide (CHX) for the indicated periods of time (0, 0.5, 1.0, 1.5, 2.0, and 2.5 h). c Fitted curves of the degradation of the RPMS1 protein of EBV variations under the damped exponential model. d Western blotting results showing the RPMS1 protein expression in NP69 cells with stable overexpression of mutant RPMS1 (-Mut) or wild-type RPMS1 (-WT), treated with or without 10 μmol/L MG132 for 1 h

Discussion

In this multi-stage association study with a large sample size, we identified an EBV genomic sequence variation represented by RPMS1 SNP G155391A that was associated with a high risk of NPC. This association is much stronger than those of non-viral environmental factors, such as the consumption of salted fish and preserved food, with NPC risk [3234]. The frequency of RPMS1 SNP G155391A was significantly associated with the NPC incidence, and higher frequencies were observed in the NPC endemic areas, suggesting that RPMS1 SNP G155391A might explain the different incidences of NPC worldwide. RPMS1 SNP G155391A was enriched in NPC patients but was not associated with other malignancies; these results support the hypothesis that there is a highly oncogenic EBV subtype specifically leading to NPC risk.

The identification of the high-risk RPMS1 SNP G155391A for NPC emphasizes that the contribution of EBV strain variation to virus-associated malignancies should not be ignored. A similar scenario is the association of human papillomavirus (HPV) with cervical carcinomas, in which highly oncogenic HPV subtypes 16, 18, and 45 are the predominant contributors to the disease among more than 150 HPV subtypes [35, 36]. Therefore, HPV vaccine programs have shown promising population-level impacts, and the screening of HPV subtypes is important for the early detection of cervical carcinomas [37]. Indeed, serological EBV markers are potentially useful for screening individuals with a high risk of NPC in multiplex families [38]. The identification of the high-risk RPMS1 SNP G155391A suggests that we should consider the contribution of EBV variations to the applications of serological EBV markers, such as DNA in NPC monitoring and prognostication [39]. With further investigation of other high-risk EBV variations, if any, we might be able to develop effective vaccines against high-risk EBV subtypes to promote NPC prevention.

RPMS1 is a unique gene belonging to the EBV BARTs family, which is abnormally expressed in most NPC tissues at the RNA level and might contribute to NPC development [25, 26]. No endogenous RPMS1 protein has been reported in cultured NPC cells or NPC tumor biopsies [40], and thus, we suspected that RPMS1 might be translated into protein at very low levels, or else that the RPMS1 protein was degraded very rapidly. Indeed, we found that the RPMS1 variations defined by 155391A and 155391G are functionally relevant to the stability of RPMS1 protein overexpressed in vitro (Fig. 2). Compared with the low-risk 155391G, the high-risk 155391A resulted in a longer half-life of RPMS1 protein, as shown in the protein degradation assays. With oncogenic capacity, RPMS1 has been shown to interact with the Notch intracellular domain and regulate the downstream pathway to promote cell differentiation and proliferation [41]. A recent genome sequencing study of NPC revealed accumulated mutations in the genes involved in the Notch pathway, including NOTCH1, NOTCH2, and NOTCH3 [42], suggesting that the dysregulation of the Notch pathway might be an important driving event in NPC. These results further suggest that the interaction between EBV-encoded RPMS1 and the host Notch pathway might be a significant process during NPC development and that the high-risk 155391A, leading to a longer half-life of RPMS1 protein, may exhibit stronger carcinogenesis potential.

Conclusions

We discovered a high-risk EBV SNP for NPC, which suggests the existence of disease-related EBV subtypes. Moreover, our findings indicate that different distributions of EBV subtypes in different geographic regions and ethnic groups might be among the reasons for the differences in NPC incidence worldwide. Therefore, our results provide new insights for screening populations at a high risk of NPC and strategies for EBV vaccine development in the future. We acknowledge that further studies with larger sample sizes, more ethnic groups, and more geographic regions are needed to replicate our findings and rule out the confounding effects of population and the source of EBV, as the RPMS1 SNP G155391A had much higher frequency in the Guangdong area based on TW samples. Certainly, more efforts are required to analyze the whole genome sequence of EBV to define haplotypes, instead of a single SNP, for genotyping the virus detected in healthy subjects or patients with different disorders and different ethnicities.

Notes

Declarations

Authors’ contributions

YXZ and JXB conceived the study and supervised the work. YMG, QSF, LZC, MX, BL, DJL, LFH, JMM, OR, QT, and SMC prepared the samples. FTF and QC performed the experiments. WHJ reviewed the cases. FTF, QC, and WSL performed the analyses. FTF, QC, JXB, and YXZ interpreted the results and wrote the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by the National Basic Research Program of China (973 Plan, No. 2011CB504301 and No. 2011CB504302), the High-Tech Research and Development Program of China (863 Plan, No. 2012AA02A206 and No. 2012AA02A501), the Program for New Century Excellent Talents at Sun Yat-sen University (No. NCET-11-0529), and the Specialized Research Fund for the Doctoral Program of Higher Education (No. 20110171120099).

We thank all the recruited participants in this work and all the staff members that participated in the sample collections from the listed institutions.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine
(2)
Department of Experimental Research, Sun Yat-sen University Cancer Center
(3)
Department of Medical Microbiology, Qingdao University Medical College
(4)
Department of Microbiology, Tumor and Cell Biology, Karolinska Institute
(5)
Department of Pathology, VU University Medical Center
(6)
Department of Clinical Oncology, The Chinese University of Hong Kong
(7)
Department of Epidemiology, Cancer Prevention Center, Sun Yat-sen University Cancer Center

References

  1. McDermott AL, Dutt SN, Watkinson JC. The aetiology of nasopharyngeal carcinoma. Clin Otolaryngol Allied Sci. 2001;26(2):82–92.PubMedView ArticleGoogle Scholar
  2. Bei JX, Li Y, Jia WH, Feng BJ, Zhou G, Chen LZ, et al. A genome-wide association study of nasopharyngeal carcinoma identifies three new susceptibility loci. Nat Genet. 2010;42(7):599–603. doi:10.1038/ng.601.PubMedView ArticleGoogle Scholar
  3. Wei WI, Sham JS. Nasopharyngeal carcinoma. Lancet. 2005;365(9476):2041–54. doi:10.1016/S0140-6736(05)66698-6.PubMedView ArticleGoogle Scholar
  4. Young LS, Rickinson AB. Epstein-Barr virus: 40 years on. Nat Rev Cancer. 2004;4(10):757–68. doi:10.1038/nrc1452.PubMedView ArticleGoogle Scholar
  5. Raab-Traub N, Flynn K, Pearson G, Huang A, Levine P, Lanier A, et al. The differentiated form of nasopharyngeal carcinoma contains Epstein-Barr virus DNA. Int J Cancer. 1987;39(1):25–9.PubMedView ArticleGoogle Scholar
  6. Chien YC, Chen JY, Liu MY, Yang HI, Hsu MM, Chen CJ, et al. Serologic markers of Epstein-Barr virus infection and nasopharyngeal carcinoma in Taiwanese men. N Engl J Med. 2001;345(26):1877–82. doi:10.1056/NEJMoa011610.PubMedView ArticleGoogle Scholar
  7. Lin JC, Wang WY, Chen KY, Wei YH, Liang WM, Jan JS, et al. Quantification of plasma Epstein-Barr virus DNA in patients with advanced nasopharyngeal carcinoma. N Engl J Med. 2004;350(24):2461–70. doi:10.1056/NEJMoa032260.PubMedView ArticleGoogle Scholar
  8. Houldcroft CJ, Kellam P. Host genetics of Epstein-Barr virus infection, latency and disease. Rev Med Virol. 2015;25(2):71–84. doi:10.1002/rmv.1816.PubMed CentralPubMedView ArticleGoogle Scholar
  9. Chang CM, Yu KJ, Mbulaiteye SM, Hildesheim A, Bhatia K. The extent of genetic diversity of Epstein-Barr virus and its geographic and disease patterns: a need for reappraisal. Virus Res. 2009;143(2):209–21. doi:10.1016/j.virusres.2009.07.005.PubMed CentralPubMedView ArticleGoogle Scholar
  10. Young LS, Dawson CW. Epstein-Barr virus and nasopharyngeal carcinoma. Chin J Cancer. 2014;33(12):581–90. doi:10.5732/cjc.014.10197.PubMed CentralPubMedGoogle Scholar
  11. Palser AL, Grayson NE, White RE, Corton C, Correia S, Ba Abdullah MM, et al. Genome diversity of Epstein-Barr virus from multiple tumor types and normal infection. J Virol. 2015;89(10):5222–37. doi:10.1128/JVI.03614-14.PubMed CentralPubMedView ArticleGoogle Scholar
  12. Niedobitek G, Young LS, Sam CK, Brooks L, Prasad U, Rickinson AB. Expression of Epstein-Barr virus genes and of lymphocyte activation molecules in undifferentiated nasopharyngeal carcinomas. Am J Pathol. 1992;140(4):879–87.PubMed CentralPubMedGoogle Scholar
  13. Dambaugh T, Hennessy K, Chamnankit L, Kieff E. U2 region of Epstein-Barr virus DNA may encode Epstein-Barr nuclear antigen 2. Proc Natl Acad Sci USA. 1984;81(23):7632–6.PubMed CentralPubMedView ArticleGoogle Scholar
  14. Sample J, Young L, Martin B, Chatman T, Kieff E, Rickinson A, et al. Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes. J Virol. 1990;64(9):4084–92.PubMed CentralPubMedGoogle Scholar
  15. Trimeche M, Bonnet C, Korbi S, Boniver J, de Leval L. Association between Epstein-Barr virus and Hodgkin’s lymphoma in Belgium: a pathological and virological study. Leuk Lymphoma. 2007;48(7):1323–31. doi:10.1080/10428190701411177.PubMedView ArticleGoogle Scholar
  16. Klemenc P, Marin J, Soba E, Gale N, Koren S, Strojan P. Distribution of Epstein-Barr virus genotypes in throat washings, sera, peripheral blood lymphocytes and in EBV positive tumor biopsies from Slovenian patients with nasopharyngeal carcinoma. J Med Virol. 2006;78(8):1083–90. doi:10.1002/jmv.20666.PubMedView ArticleGoogle Scholar
  17. Young LS, Yao QY, Rooney CM, Sculley TB, Moss DJ, Rupani H, et al. New type B isolates of Epstein-Barr virus from Burkitt’s lymphoma and from normal individuals in endemic areas. J Gen Virol. 1987;68:2853–62. doi:10.1099/0022-1317-68-11-2853.PubMedView ArticleGoogle Scholar
  18. Gutierrez MI, Raj A, Spangler G, Sharma A, Hussain A, Judde JG, et al. Sequence variations in EBNA-1 may dictate restriction of tissue distribution of Epstein-Barr virus in normal and tumour cells. J Gen Virol. 1997;78:1663–70. doi:10.1099/0022-1317-78-7-1663.PubMedView ArticleGoogle Scholar
  19. Bhatia K, Raj A, Guitierrez MI, Judde JG, Spangler G, Venkatesh H, et al. Variation in the sequence of Epstein Barr virus nuclear antigen 1 in normal peripheral blood lymphocytes and in Burkitt’s lymphomas. Oncogene. 1996;13(1):177–81.PubMedGoogle Scholar
  20. Snudden DK, Smith PR, Lai D, Ng MH, Griffin BE. Alterations in the structure of the EBV nuclear antigen, EBNA1, in epithelial cell tumours. Oncogene. 1995;10(8):1545–52.PubMedGoogle Scholar
  21. Chang KL, Chen YY, Chen WG, Hayashi K, Bacchi C, Bacchi M, et al. EBNA-1 gene sequences in Brazilian and American patients with Hodgkin’s disease. Blood. 1999;94(1):244–50.PubMedGoogle Scholar
  22. Zhang XS, Wang HH, Hu LF, Li A, Zhang RH, Mai HQ, et al. V-val subtype of Epstein-Barr virus nuclear antigen 1 preferentially exists in biopsies of nasopharyngeal carcinoma. Cancer Lett. 2004;211(1):11–8. doi:10.1016/j.canlet.2004.01.035.PubMedView ArticleGoogle Scholar
  23. Edwards RH, Seillier-Moiseiwitsch F, Raab-Traub N. Signature amino acid changes in latent membrane protein 1 distinguish Epstein-Barr virus strains. Virology. 1999;261(1):79–95. doi:10.1006/viro.1999.9855.PubMedView ArticleGoogle Scholar
  24. Li DJ, Bei JX, Mai SJ, Xu JF, Chen LZ, Zhang RH, et al. The dominance of China 1 in the spectrum of Epstein-Barr virus strains from Cantonese patients with nasopharyngeal carcinoma. J Med Virol. 2009;81(7):1253–60. doi:10.1002/jmv.21503.PubMedView ArticleGoogle Scholar
  25. Li A, Zhang XS, Jiang JH, Wang HH, Liu XQ, Pan ZG, et al. Transcriptional expression of RPMS1 in nasopharyngeal carcinoma and its oncogenic potential. Cell Cycle. 2005;4(2):304–9.PubMedGoogle Scholar
  26. Brooks LA, Lear AL, Young LS, Rickinson AB. Transcripts from the Epstein-Barr virus BamHI A fragment are detectable in all three forms of virus latency. J Virol. 1993;67(6):3182–90.PubMed CentralPubMedGoogle Scholar
  27. Smith PR, de Jesus O, Turner D, Hollyoake M, Karstegl CE, Griffin BE, et al. Structure and coding content of CST (BART) family RNAs of Epstein-Barr virus. J Virol. 2000;74(7):3082–92.PubMed CentralPubMedView ArticleGoogle Scholar
  28. Yamamoto T, Iwatsuki K. Diversity of Epstein-Barr virus BamHI-A rightward transcripts and their expression patterns in lytic and latent infections. J Med Microbiol. 2012;61(Pt 10):1445–53. doi:10.1099/jmm.0.044727-0.PubMedView ArticleGoogle Scholar
  29. Chen H, Huang J, Wu FY, Liao G, Hutt-Fletcher L, Hayward SD. Regulation of expression of the Epstein-Barr virus BamHI-A rightward transcripts. J Virol. 2005;79(3):1724–33. doi:10.1128/JVI.79.3.1724-1733.2005.PubMed CentralPubMedView ArticleGoogle Scholar
  30. Hu K, Liao D, Wu W, Han AJ, Shi HJ, Wang F, et al. Targeting the anaphase-promoting complex/cyclosome (APC/C)- bromodomain containing 7 (BRD7) pathway for human osteosarcoma. Oncotarget. 2014;5(10):3088–100.PubMed CentralPubMedView ArticleGoogle Scholar
  31. Marquitz AR, Raab-Traub N. The role of miRNAs and EBV BARTs in NPC. Semin Cancer Biol. 2012;22(2):166–72. doi:10.1016/j.semcancer.2011.12.001.PubMed CentralPubMedView ArticleGoogle Scholar
  32. Bei JX, Jia WH, Zeng YX. Familial and large-scale case-control studies identify genes associated with nasopharyngeal carcinoma. Semin Cancer Biol. 2012;22(2):96–106. doi:10.1016/j.semcancer.2012.01.012.PubMedView ArticleGoogle Scholar
  33. Hildesheim A, Wang CP. Genetic predisposition factors and nasopharyngeal carcinoma risk: a review of epidemiological association studies, 2000–2011: Rosetta Stone for NPC: genetics, viral infection, and other environmental factors. Semin Cancer Biol. 2012;22(2):107–16. doi:10.1016/j.semcancer.2012.01.007.PubMed CentralPubMedView ArticleGoogle Scholar
  34. Jia WH, Qin HD. Non-viral environmental risk factors for nasopharyngeal carcinoma: a systematic review. Semin Cancer Biol. 2012;22(2):117–26. doi:10.1016/j.semcancer.2012.01.009.PubMedView ArticleGoogle Scholar
  35. Bosch FX, Burchell AN, Schiffman M, Giuliano AR, de Sanjose S, Bruni L, et al. Epidemiology and natural history of human papillomavirus infections and type-specific implications in cervical neoplasia. Vaccine. 2008;26(Suppl 10):K1–16. doi:10.1016/j.vaccine.2008.05.064.PubMedView ArticleGoogle Scholar
  36. Doorbar J, Egawa N, Griffin H, Kranjec C, Murakami I. Human papillomavirus molecular biology and disease association. Rev Med Virol. 2015;25(suppl 1):2–23. doi:10.1002/rmv.1822.PubMedView ArticleGoogle Scholar
  37. Drolet M, Benard E, Boily MC, Ali H, Baandrup L, Bauer H, et al. Population-level impact and herd effects following human papillomavirus vaccination programmes: a systematic review and meta-analysis. Lancet Infect Dis. 2015;15(5):565–80. doi:10.1016/S1473-3099(14)71073-4.PubMedView ArticleGoogle Scholar
  38. Coghill AE, Hsu WL, Pfeiffer RM, Juwana H, Yu KJ, Lou PJ, et al. Epstein-Barr virus serology as a potential screening marker for nasopharyngeal carcinoma among high-risk individuals from multiplex families in Taiwan. Cancer Epidemiol Biomarkers Prev. 2014;23(7):1213–9. doi:10.1158/1055-9965.EPI-13-1262.PubMed CentralPubMedView ArticleGoogle Scholar
  39. Chan KC. Plasma Epstein-Barr virus DNA as a biomarker for nasopharyngeal carcinoma. Chin J Cancer. 2014;33(12):598–603. doi:10.5732/cjc.014.10192.PubMed CentralPubMedGoogle Scholar
  40. Al-Mozaini M, Bodelon G, Karstegl CE, Jin B, Al-Ahdal M, Farrell PJ. Epstein-Barr virus BART gene expression. J Gen Virol. 2009;90(Pt 2):307–16. doi:10.1099/vir.0.006551-0.PubMedView ArticleGoogle Scholar
  41. Zhang J, Chen H, Weinmaster G, Hayward SD. Epstein-Barr virus BamHi-a rightward transcript-encoded RPMS protein interacts with the CBF1-associated corepressor CIR to negatively regulate the activity of EBNA2 and NotchIC. J Virol. 2001;75(6):2946–56. doi:10.1128/JVI.75.6.2946-2956.2001.PubMed CentralPubMedView ArticleGoogle Scholar
  42. Lin DC, Meng X, Hazawa M, Nagata Y, Varela AM, Xu L, et al. The genomic landscape of nasopharyngeal carcinoma. Nat Genet. 2014;46(8):866–71. doi:10.1038/ng.3006.PubMedView ArticleGoogle Scholar

Copyright

© Feng et al. 2015

Advertisement